MIR10B (microRNA 10b)

Gene Basic Information

Gene Basic Information

symbol:
MIR10B
locus group:
non-coding RNA
location:
2q31.1
gene_family:
MicroRNAs
alias symbol:
hsa-mir-10b
alias name:
None
entrez id:
406903
ensembl gene id:
ENSG00000207744
ucsc gene id:
uc010zey.2
refseq accession:
NR_029609
hgnc_id:
HGNC:31498
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

2q31.1

Gene Summary

Gene Summary

ChineseEnglish

MicroRNAs (miRNAs) are short (20–24 nucleotide) noncoding RNAs that regulate gene expression post-transcriptionally in multicellular organisms by influencing mRNA stability and translation. miRNAs are transcribed by RNA polymerase II as capped and polyadenylated primary transcripts (pri-miRNAs), which can be protein-coding or noncoding. The primary transcript is cleaved by the RNase III enzyme Drosha to generate an approximately 70-nucleotide stem-loop precursor miRNA (pre-miRNA), which is further processed by cytoplasmic Dicer to yield a mature miRNA and an antisense miRNA star (miRNA*) product. The mature miRNA is incorporated into the RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly leads to translational repression or destabilization of the target mRNA. RefSeq represents the predicted microRNA stem-loop. [Provided by RefSeq, Sep 2009]

OMIM entry for MIR10B     Wikipedia entry for MIR10B

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR10B:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR10B:           Showing partial SNPs
rs1867863       rs57502649       rs72927167       rs77992848       rs111762840       rs113754306       rs138108736       rs138423463       rs143578082       rs147019830       rs147194633       rs181695381       rs184849795       rs186036770       rs189175209       rs189740132       rs192569387      

Gene Expression

Gene Expression

Tissue expression of MIR10B:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
CCAGAGGTTGTAACGTTGTC
59
CTGTGACTATACGGATACCAC
58
CCAGAGGTTGTAACGTTGTC
59
TGTGACTATACGGATACCACAC
60
CCAGAGGTTGTAACGTTGTC
59
GTGACTATACGGATACCACAC
58

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR10B (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR10B:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR10B:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Mammary Neoplasms 0.123810118 5 0 BeFree_CTD_human_LHGDN
Fatty Liver 0.12 1 0 CTD_human
Myocardial Reperfusion Injury 0.12 1 0 CTD_human
Drug-Induced Liver Injury 0.12 1 0 CTD_human
Glomerulonephritis 0.12 1 0 CTD_human
Malignant neoplasm of breast 0.006514605 24 0 BeFree
Breast Carcinoma 0.006514605 24 0 BeFree
Neoplasm Metastasis 0.006243163 23 0 BeFree
Malignant neoplasm of ovary 0.002638474 2 0 BeFree_GAD
Glioblastoma 0.001628651 6 0 BeFree

Related Publications

Related Publications

Investigation of the Application of miR10b and miR135b in the Identification of Semen Stains.
Tong Dayue, Jin Yi, Xue Tianyu, Ma Xiaoyan, Zhang Jinxiang, Ou Xueling, Cheng Jianding, Sun Hongyu PLoS One IF: 2.6 2016-05-25
Circulating MicroRNAs Characterizing Patients with Insufficient Coronary Collateral Artery Function.
Hakimzadeh Nazanin, Nossent A Yaël, van der Laan Anja M, Schirmer Stephan H, de Ronde Maurice W J, Pinto-Sietsma Sara-Joan, van Royen Niels, Quax Paul H A, Hoefer Imo E, Piek Jan J PLoS One IF: 2.6 2016-05-19
Circulating microRNAs - a new horizon in molecular diagnosis of breast cancer.
Hagrass Hoda A, Sharaf Samar, Pasha Heba F, Tantawy Enas A, Mohamed Randa H, Kassem Rasha Genes Cancer 2015-06-30
A comparison of genome-wide DNA methylation patterns between different vascular tissues from patients with coronary heart disease.
Nazarenko Maria S, Markov Anton V, Lebedev Igor N, Freidin Maxim B, Sleptcov Aleksei A, Koroleva Iuliya A, Frolov Aleksei V, Popov Vadim A, Barbarash Olga L, Puzyrev Valery P PLoS One IF: 2.6 2015-12-28
TGF-β-induced miR10a/b expression promotes human glioma cell migration by targeting PTEN.
Liu Shihai, Sun Junfeng, Lan Qing Mol Med Rep IF: 5.0 2014-05-28
Hepatitis C virus induced miR200c down modulates FAP-1, a negative regulator of Src signaling and promotes hepatic fibrosis.
Ramachandran Sabarinathan, Ilias Basha Haseeb, Sarma Nayan J, Lin Yiing, Crippin Jeffrey S, Chapman William C, Mohanakumar Thalachallour PLoS One IF: 2.6 2014-03-06
Universal drag tag for direct quantitative analysis of multiple microRNAs.
Wegman David W, Cherney Leonid T, Yousef George M, Krylov Sergey N Anal Chem IF: 7.3 2014-05-02
miR-9*- and miR-124a-Mediated switching of chromatin remodelling complexes is altered in rat spina bifida aperta.
Wei Xiaowei, Li Hui, Miao Jianing, Liu Bo, Zhan Yue, Wu Di, Zhang Yi, Wang Lili, Fan Yang, Gu Hui, Wang Weilin, Yuan Zhengwei Neurochem Res IF: 4.5 2014-02-06
The miR(21/10b) ratio as a prognostic marker in clear cell renal cell carcinoma.
Fritz Helena K M, Lindgren David, Ljungberg Börje, Axelson Håkan, Dahlbäck Björn Eur J Cancer IF: 7.9 2014-07-18
Transcriptional regulation of miR-10a/b by TWIST-1 in myelodysplastic syndromes.
Li Xiang, Xu Feng, Chang ChunKang, Byon John, Papayannopoulou Thalia, Deeg H Joachim, Marcondes A Mario Haematologica IF: 8.2 2013-11-26

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2