MIR1179 (microRNA 1179)

Gene Basic Information

Gene Basic Information

symbol:
MIR1179
locus group:
non-coding RNA
location:
15q26.1
gene_family:
MicroRNAs
alias symbol:
hsa-mir-1179
alias name:
None
entrez id:
100302235
ensembl gene id:
ENSG00000221630
ucsc gene id:
uc021suc.2
refseq accession:
NR_031590
hgnc_id:
HGNC:35260
approved reserved:
2008-11-03

Chromosome Location

Chromosome Location

15q26.1

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR1179     Wikipedia entry for MIR1179

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR1179:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR1179:           Showing partial SNPs
rs2350271       rs7162568       rs7163973       rs8023916       rs12914052       rs16942073       rs57192577       rs57761829       rs72763825       rs75170503       rs75216978       rs75356622       rs79381350       rs112366123       rs113242229       rs113974661       rs115168241      

Gene Expression

Gene Expression

Tissue expression of MIR1179:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
TGTATTGCCTTGTCAACCA
57
TGCTCACTCAGCTAGTCAG
59
GCATTCTTTCATTGGTTGGTG
59
GGATAAATGGCATCCTCTTATTGG
60
TTGCCTTGTCAACCAATAAGAG
59
CCTGCTCACTCAGCTAGTC
60

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR1179 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR1179:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR1179:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Neoplasm Metastasis 0.000542884 2 0 BeFree
Colorectal Cancer 0.000542884 2 0 BeFree
Squamous cell carcinoma of esophagus 0.000271442 1 0 BeFree
Breast Cancer, Familial 0.000271442 1 0 BeFree
Sporadic Breast Carcinoma 0.000271442 1 0 BeFree
Colorectal Carcinoma 0.000271442 1 0 BeFree

Related Publications

Related Publications

A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function.
Porcu Eleonora, Medici Marco, Pistis Giorgio, Volpato Claudia B, Wilson Scott G, Cappola Anne R, Bos Steffan D, Deelen Joris, den Heijer Martin, Freathy Rachel M, Lahti Jari, Liu Chunyu, Lopez Lorna M, Nolte Ilja M, O'Connell Jeffrey R, Tanaka Toshiko, Trompet Stella, Arnold Alice, Bandinelli Stefania, Beekman Marian, Böhringer Stefan, Brown Suzanne J, Buckley Brendan M, Camaschella Clara, de Craen Anton J M, Davies Gail, de Visser Marieke C H, Ford Ian, Forsen Tom, Frayling Timothy M, Fugazzola Laura, Gögele Martin, Hattersley Andrew T, Hermus Ad R, Hofman Albert, Houwing-Duistermaat Jeanine J, Jensen Richard A, Kajantie Eero, Kloppenburg Margreet, Lim Ee M, Masciullo Corrado, Mariotti Stefano, Minelli Cosetta, Mitchell Braxton D, Nagaraja Ramaiah, Netea-Maier Romana T, Palotie Aarno, Persani Luca, Piras Maria G, Psaty Bruce M, Räikkönen Katri, Richards J Brent, Rivadeneira Fernando, Sala Cinzia, Sabra Mona M, Sattar Naveed, Shields Beverley M, Soranzo Nicole, Starr John M, Stott David J, Sweep Fred C G J, Usala Gianluca, van der Klauw Melanie M, van Heemst Diana, van Mullem Alies, Vermeulen Sita H, Visser W Edward, Walsh John P, Westendorp Rudi G J, Widen Elisabeth, Zhai Guangju, Cucca Francesco, Deary Ian J, Eriksson Johan G, Ferrucci Luigi, Fox Caroline S, Jukema J Wouter, Kiemeney Lambertus A, Pramstaller Peter P, Schlessinger David, Shuldiner Alan R, Slagboom Eline P, Uitterlinden André G, Vaidya Bijay, Visser Theo J, Wolffenbuttel Bruce H R, Meulenbelt Ingrid, Rotter Jerome I, Spector Tim D, Hicks Andrew A, Toniolo Daniela, Sanna Serena, Peeters Robin P, Naitza Silvia PLoS Genet IF: 0.000 2013-06-13

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2