MIR137 (microRNA 137)

Gene Basic Information

Gene Basic Information

symbol:
MIR137
locus group:
non-coding RNA
location:
1p21.3
gene_family:
MicroRNAs
alias symbol:
hsa-mir-137|miR-137
alias name:
None
entrez id:
406928
ensembl gene id:
ENSG00000284202
ucsc gene id:
uc021oqk.1
refseq accession:
NR_029679
hgnc_id:
HGNC:31523
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

1p21.3

Gene Summary

Gene Summary

ChineseEnglish

MIR137 encodes a microRNA, a short (20–24 nucleotide) noncoding RNA that post-transcriptionally regulates gene expression in multicellular organisms by affecting mRNA stability and translation. MicroRNAs are transcribed by RNA polymerase II as capped and polyadenylated primary transcripts (pri-miRNAs), which may be protein-coding or noncoding. The primary transcript is cleaved by the RNase III enzyme Drosha to generate an approximately 70-nucleotide stem-loop precursor miRNA (pre-miRNA), which is further processed by cytoplasmic Dicer to yield the mature miRNA and an antisense miRNA star (miRNA*) product. The mature miRNA is incorporated into the RNA-induced silencing complex (RISC), where it recognizes target mRNAs through imperfect base pairing and typically causes translational repression or destabilization of the target mRNA. The RefSeq record represents a predicted microRNA stem-loop. [Provided by RefSeq, Sep 2009]

OMIM entry for MIR137     Wikipedia entry for MIR137

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR137:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR137:           Showing partial SNPs
rs2660303       rs2660304       rs2997475       rs11165946       rs71071683       rs75784148       rs75853046       rs76936626       rs78422095       rs111459339       rs112693582       rs112984663       rs113227460       rs113401150       rs115108429       rs115636918       rs116163798      

Gene Expression

Gene Expression

Tissue expression of MIR137:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
GGGTGGATAATACGGATTACGT
60
GGTACTCTCCTCGACTACG
58
GGGTGGATAATACGGATTACG
58
GGTACTCTCCTCGACTACG
58
TGGGTGGATAATACGGATTACG
60
GTACTCTCCTCGACTACGC
59

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR137 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR137:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR137:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Schizophrenia 0.127057489 26 2 BeFree_CTD_human
Myocardial Reperfusion Injury 0.12 1 0 CTD_human
Cocaine-Related Disorders 0.12 1 0 CTD_human
Rectal Neoplasms 0.00272435 1 0 LHGDN
Glioblastoma 0.002171535 8 0 BeFree
Colorectal Cancer 0.001900093 7 0 BeFree
Colorectal Carcinoma 0.001900093 7 0 BeFree
Bipolar Disorder 0.001357209 5 1 BeFree
melanoma 0.001357209 5 0 BeFree
Neoplasm Metastasis 0.001357209 5 0 BeFree

Related Publications

Related Publications

Molecular Links Between Smoking, COPD, and Lung Cancer: A DNA Methylation Perspective.
Forigua CB, Bermúdez LG, Cañas Arboleda A, Ariza RR, Roldán MT, Morales MT, González Cubides DM, Rojas A Cancers (Basel) 2026-04-17
Scalable single-cell total RNA sequencing unifies coding and noncoding transcriptomics.
Isakova A, Liu DD, Cvijović I, Sinha R, Eastman AE, Saul S, Detweiler AM, Neff N, Einav S, Weissman IL, Quake SR Nat Biotechnol IF: 44.5 2026-03-31
Scalable single-cell total RNA-seq reveals non-coding programs in immunity, infection, and brain development.
Isakova A, Quake S, Liu D, Cvijovic I, Sinha R, Eastman A, Saul S, Detweiler A, Neff N, Einav S, Weissman I Res Sq 2025-09-08
The impact of genome wide supported microRNA-137 (MIR137) risk variants on frontal and striatal white matter integrity, neurocognitive functioning, and negative symptoms in schizophrenia.
Kuswanto Carissa Nadia, Sum Min Yi, Qiu Anqi, Sitoh Yih-Yian, Liu Jianjun, Sim Kang Am J Med Genet B Neuropsychiatr Genet IF: 1.4 2016-03-11
Silencing of miR-137 by aberrant promoter hypermethylation in surgically resected lung cancer.
Kang Nahyeon, Choi Su Yeon, Kim Young Kyoon, Yoo Ie Ryung, Han Dae Hee, Lee Dong Soo, Kim Yeon Sil, Hong Sook Hee, Kang Jin Hyoung, Lee Kyo Young, Park Jae Kil, Sung Sook Whan, Park Mi Sun, Yim Hyeon Woo, Kim Seung Joon, Park Jong Y Lung Cancer IF: 5.3 2016-05-05
MIR137 Regulates Starvation-Induced Autophagy by Targeting ATG7.
Zeng Yuecheng, Huo Gang, Mo Yongbiao, Wang Wentao, Chen Hong J Mol Neurosci IF: 2.4 2016-06-27
Loci with genome-wide associations with schizophrenia in the Han Chinese population.
Li Zhiqiang, Xiang Yuqian, Chen Jianhua, Li Qiaoli, Shen Jiawei, Liu Yun, Li Wenjin, Xing Qinghe, Wang Qingzhong, Wang Lei, Feng Guoyin, He Lin, Zhao Xinzhi, Shi Yongyong Br J Psychiatry IF: 8.5 2016-10-21
A functional variant in MIR137, a candidate gene for schizophrenia, affects Stroop test performance in young adults.
González-Giraldo Yeimy, González-Reyes Rodrigo E, Forero Diego A Psychiatry Res IF: 5.1 2016-10-11
MiR137 is an androgen regulated repressor of an extended network of transcriptional coregulators.
Nilsson Emeli M, Laursen Kristian B, Whitchurch Jonathan, McWilliam Andrew, Ødum Niels, Persson Jenny L, Heery David M, Gudas Lorraine J, Mongan Nigel P Oncotarget IF: 5.168 2016-08-29
Characterization of a REST-Regulated Internal Promoter in the Schizophrenia Genome-Wide Associated Gene MIR137.
Warburton Alix, Breen Gerome, Rujescu Dan, Bubb Vivien J, Quinn John P Schizophr Bull IF: 5.7 2016-01-29

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2