MIR145 (microRNA 145)

Gene Basic Information

Gene Basic Information

symbol:
MIR145
locus group:
non-coding RNA
location:
5q32
gene_family:
MicroRNAs
alias symbol:
hsa-mir-145|MIR-145
alias name:
None
entrez id:
406937
ensembl gene id:
ENSG00000276365
ucsc gene id:
uc063iom.1
refseq accession:
NR_029686
hgnc_id:
HGNC:31532
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

5q32

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR145     Wikipedia entry for MIR145

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR145:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR145:           Showing partial SNPs
rs353291       rs431255       rs13158382       rs28428637       rs34290100       rs41291957       rs55857000       rs55945735       rs59810862       rs60133540       rs73798217       rs74693964       rs76308668       rs77228332       rs80026971       rs112274740       rs113013728      

Gene Expression

Gene Expression

Tissue expression of MIR145:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
CCAGGAATCCCTTAGATGC
57
AACCATGACCTCAAGAACAG
58
CCAGGAATCCCTTAGATGCT
59
ACCATGACCTCAAGAACAG
57
CCAGGAATCCCTTAGATGC
57
ACCATGACCTCAAGAACAG
57

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR145 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR145:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR145:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Non-Small Cell Lung Carcinoma 0.122714419 11 0 BeFree_CTD_human
Esophageal Neoplasms 0.120814326 3 0 BeFree_CTD_human
Albuminuria 0.12 1 0 CTD_human
Liver Neoplasms, Experimental 0.12 1 0 CTD_human
Precancerous Conditions 0.12 1 0 CTD_human
B-Cell Lymphomas 0.12 1 0 CTD_human
Mammary Neoplasms 0.12 1 0 CTD_human
Diabetic Nephropathy 0.12 1 0 CTD_human
Chronic Lymphocytic Leukemia 0.12 1 0 CTD_human
Prostate carcinoma 0.005428837 20 0 BeFree

Related Publications

Related Publications

HDL Regulates TGFβ-Receptor Lipid Raft Partitioning, Restoring Contractile Features of Cholesterol-Loaded Vascular Smooth Muscle Cells.
Nagesh PT, Rawal S, Nishi H, Zahr T, Miano JM, Sorci-Thomas M, Xu H, Akbar N, Choudhury RP, Feinberg MW, Misra A, Fisher EA JACC Basic Transl Sci IF: 8.4 2026-03-00
Novel Biomaterial-Based Synovial Fluid Analysis Reveals Protective microRNA Signatures in a Mouse Model of Acute Synovitis-Driven Osteoarthritis.
Takahata K, Arakawa K, Yasuda T, Enomoto S, Katashima T, Sakai T, Kokubun T FASEB J IF: 4.3 2026-06-30
Circulating microRNAs as Early Biomarkers of Colon Cancer: A Nested Case-Control Study Within a Prospective Cohort.
Padroni L, Marmiroli G, De Marco L, Fiano V, Dansero L, Caini S, Masala G, Manfredi L, Milani L, Ricceri F, Sacerdote C Int J Mol Sci IF: 3.226 2025-08-15
A precision medicine approach to the myelodysplastic syndrome with isolated deletion 5q, 50 years after its discovery.
Roncador M, Bernard E, Hasserjian R, Boultwood J, Elena C, Gallì A, Gurnari C, Mecucci C, Michaux L, Mittelman M, Sarchi M, Travaglino E, McLornan DP, Ogawa S, Papaemmanuil E, Hellström Lindberg E, Malcovati L, Cazzola M Blood IF: 23.9 2025-10-16
Transcriptional regulation of BNIP3 by Sp3 in prostate cancer.
Huang Ying, Shen Pengfei, Chen Xueqin, Chen Zhibin, Zhao Tao, Chen Ni, Gong Jing, Nie Ling, Xu Miao, Li Xinglan, Zeng Hao, Zhou Qiao Prostate IF: 2.7 2016-04-26
Vasorin is a potential serum biomarker and drug target of hepatocarcinoma screened by subtractive-EMSA-SELEX to clinic patient serum.
Li Shaohua, Li Hui, Yang Xiqin, Wang Wei, Huang Aixue, Li Jie, Qin Xingliang, Li Fei, Lu Guanyi, Ding Hongmei, Su Xueting, Hou Lvbin, Xia Wei, Shi Ming, Zhang Hongwen, Zhao Qiang, Dong Jie, Ge Xingfeng, Sun Leqiao, Bai Chenjun, Wang Chaonan, Shen Xuelian, Fang Tao, Wang Fusheng, Zhang Heqiu, Shao Ningsheng Oncotarget IF: 5.168 2016-04-05
Human Antigen R Binding and Regulation of SOX2 mRNA in Human Mesenchymal Stem Cells.
Latorre Elisa, Carelli Stephana, Caremoli Filippo, Giallongo Toniella, Colli Mattia, Canazza Alessandra, Provenzani Alessandro, Di Giulio Anna Maria, Gorio Alfredo Mol Pharmacol IF: 3.0 2016-05-13
Genetic association analysis of miRNA SNPs implicates MIR145 in breast cancer susceptibility.
Chacon-Cortes Diego, Smith Robert A, Haupt Larisa M, Lea Rodney A, Youl Philippa H, Griffiths Lyn R BMC Med Genet IF: 2.198 2016-04-25
Identification of a microRNA signature for the diagnosis of fibromyalgia.
Cerdá-Olmedo Germán, Mena-Durán Armando Vicente, Monsalve Vicente, Oltra Elisa PLoS One IF: 2.6 2016-02-08

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2