MIR146B (microRNA 146b)

Gene Basic Information

Gene Basic Information

symbol:
MIR146B
locus group:
non-coding RNA
location:
10q24.32
gene_family:
MicroRNAs
alias symbol:
hsa-mir-146b
alias name:
None
entrez id:
574447
ensembl gene id:
ENSG00000202569
ucsc gene id:
uc021pxj.2
refseq accession:
NR_030169
hgnc_id:
HGNC:32079
approved reserved:
2005-07-15

Chromosome Location

Chromosome Location

10q24.32

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR146B     Wikipedia entry for MIR146B

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR146B:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR146B:           Showing partial SNPs
rs148003733       rs544624168       rs554766362       rs559245866       rs562833864       rs573414055       rs577467403       rs1536309       rs1926122       rs2224374       rs74878980       rs76149940       rs77128363       rs78170991       rs78923856       rs116120836       rs116977473      

Gene Expression

Gene Expression

Tissue expression of MIR146B:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
ACTGAGAACTGAATTCCATAGG
58
ACCAGAACTGAGTCCACAG
59
GCACTGAGAACTGAATTCCA
58
CAGAACTGAGTCCACAGGG
60
CACTGAGAACTGAATTCCATAGG
59
CCAGAACTGAGTCCACAGG
60

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR146B (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR146B:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR146B:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Noise-induced hearing loss 0.12 1 0 CTD_human
Neoplasm Recurrence, Local 0.12 1 0 CTD_human
Coronary Artery Disease 0.12 1 0 CTD_human
Mammary Neoplasms 0.00272435 1 0 LHGDN
Neoplasm Metastasis 0.00272435 1 0 LHGDN
Papillary thyroid carcinoma 0.000271442 1 0 BeFree
Malignant neoplasm of gallbladder 0.000271442 1 0 BeFree
Glioma 0.000271442 1 0 BeFree
Gallbladder Carcinoma 0.000271442 1 0 BeFree

Related Publications

Related Publications

The BDNF Val66Met variant affects gene expression through miR-146b.
Hsu Pei-Ken, Xu Bin, Mukai Jun, Karayiorgou Maria, Gogos Joseph A Neurobiol Dis IF: 6.0 2016-01-06
Clinico-Pathological Association of Delineated miRNAs in Uveal Melanoma with Monosomy 3/Disomy 3 Chromosomal Aberrations.
Venkatesan Nalini, Kanwar Jagat, Deepa Perinkulam Ravi, Khetan Vikas, Crowley Tamsyn M, Raguraman Rajeswari, Sugneswari Ganesan, Rishi Pukhraj, Natarajan Viswanathan, Biswas Jyotirmay, Krishnakumar Subramanian PLoS One IF: 2.6 2016-07-20
A novel role of microRNA146b in promoting mammary alveolar progenitor cell maintenance.
Elsarraj Hanan S, Hong Yan, Valdez Kelli, Carletti Martha, Salah Sally M, Raimo Monica, Taverna Daniela, Prochasson Philippe, Bharadwaj Uddalak, Tweardy David J, Christenson Lane K, Behbod Fariba J Cell Sci IF: 3.9 2013-11-12
MicroRNAs miR-146-5p and let-7f as prognostic tools for aggressive papillary thyroid carcinoma: a case report.
Geraldo Murilo Vieira, Fuziwara Cesar Seigi, Friguglieti Celso Ubirajara Moretto, Costa Ricardo Borges, Kulcsar Marco Aurélio Vamondes, Yamashita Alex Shimura, Kimura Edna Teruko Arq Bras Endocrinol Metabol IF: 1.193 2013-12-09
Differential regulation of microRNA-146a and microRNA-146b-5p in human retinal pigment epithelial cells by interleukin-1β, tumor necrosis factor-α, and interferon-γ.
Kutty R Krishnan, Nagineni Chandrasekharam N, Samuel William, Vijayasarathy Camasamudram, Jaworski Cynthia, Duncan Todd, Cameron Jennifer E, Flemington Erik K, Hooks John J, Redmond T Michael Mol Vis IF: 1.8 2013-09-24
Mutation screening of MIR146A/B and BRCA1/2 3'-UTRs in the GENESIS study.
Garcia Amandine I, Buisson Monique, Damiola Francesca, Tessereau Chloé, Barjhoux Laure, Verny-Pierre Carole, Sornin Valérie, Dondon Marie-Gabrielle, Eon-Marchais Séverine, , Caron Olivier, Gautier-Villars Marion, Coupier Isabelle, Buecher Bruno, Vennin Philippe, Belotti Muriel, Lortholary Alain, Gesta Paul, Dugast Catherine, Noguès Catherine, Fricker Jean-Pierre, Faivre Laurence, Stoppa-Lyonnet Dominique, Andrieu Nadine, Sinilnikova Olga M, Mazoyer Sylvie Eur J Hum Genet IF: 4.6 0000-00-00
Value of distinguishing differentiated thyroid carcinoma by miRNA.
Xu Jianlin, Zhang Ding, Niu Qian, Nan Yonggang, Shi Changbei, Zhao Hua, Liang Xiaoyan Oncol Lett IF: 2.1 0000-00-00
p16 induces senescence and inhibits EMT through microRNA-141/microRNA-146b-5p-dependent repression of AUF1.
Al-Khalaf Huda H, Aboussekhra Abdelilah Mol Carcinog IF: 3.5 0000-00-00
Ibrutinib downregulates a subset of miRNA leading to upregulation of tumor suppressors and inhibition of cell proliferation in chronic lymphocytic leukemia.
Saleh L M, Wang W, Herman S E M, Saba N S, Anastas V, Barber E, Corrigan-Cummins M, Farooqui M, Sun C, Sarasua S M, Zhao Z, Abousamra N K, Elbaz O, Abdelghaffar H A, Wiestner A, Calvo K R Leukemia IF: 8.8 0000-00-00
Differential DNA Methylation of MicroRNA Genes in Temporal Cortex from Alzheimer's Disease Individuals.
Villela Darine, Ramalho Rodrigo F, Silva Aderbal R T, Brentani Helena, Suemoto Claudia K, Pasqualucci Carlos Augusto, Grinberg Lea T, Krepischi Ana C V, Rosenberg Carla Neural Plast IF: 3.4 0000-00-00

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2