MIR182 (microRNA 182)

Gene Basic Information

Gene Basic Information

symbol:
MIR182
locus group:
non-coding RNA
location:
7q32.2
gene_family:
MicroRNAs
alias symbol:
hsa-mir-182|miR-182
alias name:
None
entrez id:
406958
ensembl gene id:
ENSG00000207990
ucsc gene id:
uc011kpb.2
refseq accession:
NR_029614
hgnc_id:
HGNC:31553
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

7q32.2

Gene Summary

Gene Summary

ChineseEnglish

MIR182 is a microRNA gene. MicroRNAs (miRNAs) are short (20–24 nucleotides) noncoding RNAs that post-transcriptionally regulate gene expression in multicellular organisms by affecting mRNA stability and translation. They are transcribed by RNA polymerase II as capped and polyadenylated primary transcripts (pri-miRNAs), which can be protein-coding or noncoding. Drosha ribonuclease III cleaves pri-miRNAs to produce ~70-nucleotide stem-loop precursor miRNAs (pre-miRNAs), which cytoplasmic Dicer further processes into mature miRNA and antisense miRNA* products. Mature miRNA is incorporated into the RNA-induced silencing complex (RISC), which recognizes target mRNAs by imperfect base pairing and usually causes translational repression or destabilization of the target mRNA. RefSeq represents the predicted MIR182 microRNA stem-loop. [Provided by RefSeq, Sep 2009]

OMIM entry for MIR182     Wikipedia entry for MIR182

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR182:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR182:           Showing partial SNPs
rs4467881       rs4541843       rs7809195       rs17557575       rs75458972       rs75953509       rs76481776       rs77368416       rs77586312       rs80041074       rs117487540       rs118167315       rs137909244       rs138262615       rs140774601       rs146919637       rs147680562      

Gene Expression

Gene Expression

Tissue expression of MIR182:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
AATGGTAGAACTCACACTGG
57
CATAGTTGGCAAGTCTAGAACC
59
GGCAATGGTAGAACTCACAC
59
AGTTGGCAAGTCTAGAACC
57
CAATGGTAGAACTCACACTGG
59
ATAGTTGGCAAGTCTAGAACC
58

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR182 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR182:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR182:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
melanoma 0.004353001 6 0 BeFree_LHGDN
Neoplasm Metastasis 0.00434307 16 0 BeFree
Sleep Initiation and Maintenance Disorders 0.002367032 1 0 GAD
Ovarian Carcinoma 0.001900093 7 0 BeFree
Carcinoma of lung 0.001900093 7 0 BeFree
Malignant neoplasm of ovary 0.001900093 7 0 BeFree
Malignant neoplasm of lung 0.001900093 7 0 BeFree
Colorectal Carcinoma 0.001628651 6 0 BeFree
Malignant neoplasm of breast 0.001628651 6 0 BeFree
Carcinogenesis 0.001628651 6 0 BeFree

Related Publications

Related Publications

Anti-miR182 reduces ovarian cancer burden, invasion, and metastasis: an in vivo study in orthotopic xenografts of nude mice.
Xu Xiaofei, Ayub Bushra, Liu Zhaojian, Serna Vanida Ann, Qiang Wenan, Liu Yugang, Hernando Eva, Zabludoff Sonya, Kurita Takeshi, Kong Beihua, Wei Jian-Jun Mol Cancer Ther IF: 6.9 2015-04-20
Genome wide expression profiling of p53 regulated miRNAs in neuroblastoma.
Rihani Ali, Van Goethem Alan, Ongenaert Maté, De Brouwer Sara, Volders Pieter-Jan, Agarwal Saurabh, De Preter Katleen, Mestdagh Pieter, Shohet Jason, Speleman Frank, Vandesompele Jo, Van Maerken Tom Sci Rep IF: 4.9 2015-10-16
miR-182 is largely dispensable for adaptive immunity: lack of correlation between expression and function.
Pucella Joseph N, Yen Wei-Feng, Kim Myoungjoo V, van der Veeken Joris, Luo Chong T, Socci Nicholas D, Naito Yukiko, Li Ming O, Iwai Naoharu, Chaudhuri Jayanta J Immunol IF: 4.0 2015-06-19
The role of miR-182 in regulating pineal CLOCK expression after hypoxia-ischemia brain injury in neonatal rats.
Ding Xin, Sun Bin, Huang Jian, Xu Lixiao, Pan Jian, Fang Chen, Tao Yanfang, Hu Shukun, Li Ronghu, Han Xing, Miao Po, Wang Ying, Yu Jian, Feng Xing Neurosci Lett IF: 2.2 2015-09-15
Expression analysis of MIR182 and its associated target genes in advanced ovarian carcinoma.
McMillen Brian D, Aponte Margarita M, Liu Zhaojian, Helenowski Irene B, Scholtens Denise M, Buttin Barbara M, Wei Jian-Jun Mod Pathol IF: 6.6 2013-06-06
Integrated profiling of diffuse large B-cell lymphoma with 7q gain.
Chigrinova Ekaterina, Mian Michael, Shen Yulei, Greiner Timothy C, Chan Wing C, Vose Julie M, Inghirami Giorgio, Chiappella Annalisa, Baldini Luca, Ponzoni Maurilio, Ferreri Andrés J M, Franceschetti Silvia, Gaidano Gianluca, Tucci Alessandra, Facchetti Fabio, Lazure Thierry, Lambotte Olivier, Montes-Moreno Santiago, Piris Miguel A, Zucca Emanuele, Kwee Ivo, Bertoni Francesco Br J Haematol IF: 3.6 2011-07-05
Protection against cellular stress by 25-hydroxyvitamin D3 in breast epithelial cells.
Peng Xinjian, Vaishnav Avani, Murillo Genoveva, Alimirah Fatouma, Torres Karen E O, Mehta Rajendra G J Cell Biochem IF: 3.0 2010-10-29
A Common Variant in MIR182 Is Associated With Primary Open-Angle Glaucoma in the NEIGHBORHOOD Consortium.
Liu Yutao, Bailey Jessica Cooke, Helwa Inas, Dismuke W Michael, Cai Jingwen, Drewry Michelle, Brilliant Murray H, Budenz Donald L, Christen William G, Chasman Daniel I, Fingert John H, Gaasterland Douglas, Gaasterland Terry, Gordon Mae O, Igo Robert P, Kang Jae H, Kass Michael A, Kraft Peter, Lee Richard K, Lichter Paul, Moroi Sayoko E, Realini Anthony, Richards Julia E, Ritch Robert, Schuman Joel S, Scott William K, Singh Kuldev, Sit Arthur J, Song Yeunjoo E, Vollrath Douglas, Weinreb Robert, Medeiros Felipe, Wollstein Gadi, Zack Donald J, Zhang Kang, Pericak-Vance Margaret A, Gonzalez Pedro, Stamer W Daniel, Kuchtey John, Kuchtey Rachel W, Allingham R Rand, Hauser Michael A, Pasquale Louis R, Haines Jonathan L, Wiggs Janey L Invest Ophthalmol Vis Sci IF: 5.5 0000-00-00

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2