MIR200A (microRNA 200a)

Gene Basic Information

Gene Basic Information

symbol:
MIR200A
locus group:
non-coding RNA
location:
1p36.33
gene_family:
MicroRNAs
alias symbol:
hsa-mir-200a
alias name:
None
entrez id:
406983
ensembl gene id:
ENSG00000207607
ucsc gene id:
uc010nye.2
refseq accession:
NR_029834
hgnc_id:
HGNC:31578
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

1p36.33

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR200A     Wikipedia entry for MIR200A

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR200A:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR200A:           Showing partial SNPs
rs7518873       rs9442386       rs61768480       rs72563729       rs72563730       rs77342103       rs80296038       rs111233725       rs111652490       rs112604916       rs112845159       rs113882248       rs114049361       rs114497437       rs115542311       rs140316058       rs143277733      

Gene Expression

Gene Expression

Tissue expression of MIR200A:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
TGAGCATCTTACCGGACAG
59
TCGTTACCAGACAGTGTTAGAG
60
TGTGAGCATCTTACCGGAC
60
GTTACCAGACAGTGTTAGAGTC
58
CATCTTACCGGACAGTGCT
60
AACATCGTTACCAGACAGTG
58

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR200A (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR200A:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR200A:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Malignant neoplasm of ovary 0.002909916 3 0 BeFree_GAD
Tumor Progression 0.000814326 3 0 BeFree
Liver carcinoma 0.000814326 3 0 BeFree
Ovarian Carcinoma 0.000814326 3 0 BeFree
Malignant neoplasm of breast 0.000814326 3 0 BeFree
Breast Carcinoma 0.000814326 3 0 BeFree
Meningioma 0.000271442 1 0 BeFree
melanoma 0.000271442 1 0 BeFree
Central neuroblastoma 0.000271442 1 0 BeFree
Neoplasm Metastasis 0.000271442 1 0 BeFree

Related Publications

Related Publications

Identification of miR-200a as a novel suppressor of connexin 43 in breast cancer cells.
Ming Jia, Zhou Yan, Du Junze, Fan Shenghao, Pan Beibei, Wang Yinhuan, Fan Lingjun, Jiang Jun Biosci Rep IF: 4.5 2016-06-14
Molecular cystoscopy: Micro-RNAs could be a marker for identifying genotypic changes for transitional cell carcinoma of the urinary bladder.
Mitash Nilay, Agnihotri Shalini, Mittal Balraj, Tiwari Swasti, Mandhani Anil Indian J Urol IF: 1.0 2016-04-29
Androgen receptor as a regulator of ZEB2 expression and its implications in epithelial-to-mesenchymal transition in prostate cancer.
Jacob Sheeba, Nayak S, Fernandes Gwendolyn, Barai R S, Menon S, Chaudhari U K, Kholkute S D, Sachdeva Geetanjali Endocr Relat Cancer IF: 4.4 2015-01-22
A ten-microRNA signature identified from a genome-wide microRNA expression profiling in human epithelial ovarian cancer.
Wang Lin, Zhu Miao-Jun, Ren Ai-Min, Wu Hong-Fei, Han Wu-Mei, Tan Ruo-Ying, Tu Rui-Qin PLoS One IF: 2.6 2015-10-19
Molecular regulation of ovarian cancer cell invasion.
Sun Ningxia, Zhang Qing, Xu Chen, Zhao Qian, Ma Yan, Lu Xinmei, Wang Liang, Li Wen Tumour Biol IF: 3.650 2015-04-17
Differential expression of miR200a-3p and miR21 in grade II-III and grade IV gliomas: evidence that miR200a-3p is regulated by O⁶-methylguanine methyltransferase and promotes temozolomide responsiveness.
Berthois Yolande, Delfino Christine, Metellus Philippe, Fina Frederic, Nanni-Metellus Isabelle, Al Aswy Hayat, Pirisi Victor, Ouafik L'Houcine, Boudouresque Françoise Cancer Biol Ther IF: 5.7 2015-02-13
MicroRNA-200a and -200b mediated hepatocellular carcinoma cell migration through the epithelial to mesenchymal transition markers.
Hung Chin-Sheng, Liu Hui-Hsiung, Liu Jun-Jen, Yeh Chi-Tai, Chang Tung-Cheng, Wu Chih-Hsiung, Ho Yuan-Soon, Wei Po-Li, Chang Yu-Jia Ann Surg Oncol IF: 3.8 2014-08-28
Activation of miR200 by c-Myb depends on ZEB1 expression and miR200 promoter methylation.
Pieraccioli Marco, Imbastari Francesca, Antonov Alexey, Melino Gerry, Raschellà Giuseppe Cell Cycle IF: 3.9 2014-03-05
Effect of miR27a on proliferation and invasion in colonic cancer cells.
Gao Yang, Li Bao-Dong, Liu Yong-Gang Asian Pac J Cancer Prev IF: 0.000 2014-05-15
Expression of MiR200a, miR93, metastasis-related gene RECK and MMP2/MMP9 in human cervical carcinoma--relationship with prognosis.
Wang Ling, Wang Qiang, Li He-Lian, Han Li-Ying Asian Pac J Cancer Prev IF: 0.000 2014-01-07

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2