MIR22 (microRNA 22)

Gene Basic Information

Gene Basic Information

symbol:
MIR22
locus group:
non-coding RNA
location:
17p13.3
gene_family:
MicroRNAs
alias symbol:
hsa-mir-22
alias name:
None
entrez id:
407004
ensembl gene id:
ENSG00000283824
ucsc gene id:
uc032gnj.2
refseq accession:
NR_029494
hgnc_id:
HGNC:31599
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

17p13.3

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR22     Wikipedia entry for MIR22

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR22:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR22:           Showing partial SNPs
rs1075485       rs4790812       rs6502892       rs11078596       rs11078597       rs11658449       rs35933654       rs73291038       rs73291042       rs73976265       rs75316528       rs111505806       rs111969187       rs112649732       rs113734781       rs114423128       rs114632535      

Gene Expression

Gene Expression

Tissue expression of MIR22:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
TAGTTCTTCAGTGGCAAGC
58
ACAGTTCTTCAACTGGCAG
58
CCGCAGTAGTTCTTCAGTG
58
CTTCAACTGGCAGCTTTAGC
60
GTAGTTCTTCAGTGGCAAGC
59
CAGTTCTTCAACTGGCAGC
60

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR22 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR22:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR22:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Drug-Induced Liver Injury 0.12 1 0 CTD_human
Neoplasm Metastasis 0.002714419 10 0 BeFree
Carcinogenesis 0.001628651 6 0 BeFree
Stomach Carcinoma 0.001357209 5 0 BeFree
Colon Carcinoma 0.001357209 5 0 BeFree
Malignant neoplasm of stomach 0.001357209 5 0 BeFree
Malignant tumor of colon 0.001357209 5 0 BeFree
Liver carcinoma 0.001085767 4 0 BeFree
leukemia 0.001085767 4 0 BeFree
Ovarian Carcinoma 0.000814326 3 0 BeFree

Related Publications

Related Publications

Microribonucleic acid dysregulations in children and adolescents with obsessive-compulsive disorder.
Kandemir Hasan, Erdal Mehmet Emin, Selek Salih, İzci Ay Özlem, Karababa İbrahim Fatih, Ay Mustafa Ertan, Kandemir Sultan Basmacı, Yılmaz Şenay Görücü, Ekinci Suat, Taşdelen Bahar, Bayazit Hüseyin Neuropsychiatr Dis Treat IF: 0.000 2015-07-23
Evaluation of several micro RNA (miRNA) levels in children and adolescents with attention deficit hyperactivity disorder.
Kandemir Hasan, Erdal Mehmet Emin, Selek Salih, Ay Özlem İzci, Karababa Ibrahim Fatih, Kandemir Sultan Basmacı, Ay Mustafa Ertan, Yılmaz Şenay Görücü, Bayazıt Hüseyin, Taşdelen Bahar Neurosci Lett IF: 2.2 2015-06-08
[Biological characteristics of exosomes secreted by human bone marrow mesenchymal stem cells].
Feng Ying, Lu Shi-Hong, Wang Xin, Cui Jun-Jie, Li Xue, DU Wen-Jing, Wang Ying, Li Juan-Juan, Song Bao-Quan, Chen Fang, Ma Feng-Xia, Chi Ying, Yang Shao-Guang, Han Zhong-Chao Zhongguo Shi Yan Xue Ye Xue Za Zhi 2014-12-11
Microarray profiling of monocytic differentiation reveals miRNA-mRNA intrinsic correlation.
Wang Jing, Xiang Guangxing, Mitchelson Keith, Zhou Yuxiang J Cell Biochem IF: 3.0 2011-12-07
Gene silencing of MIR22 in acute lymphoblastic leukaemia involves histone modifications independent of promoter DNA methylation.
Li Xiaoqing, Liu Jun, Zhou Rui, Huang Shi, Huang Shiang, Chen Xian-Ming Br J Haematol IF: 3.6 2010-04-05
PDE5 Inhibition Ameliorates Visceral Adiposity Targeting the miR-22/SIRT1 Pathway: Evidence From the CECSID Trial.
Fiore Daniela, Gianfrilli Daniele, Giannetta Elisa, Galea Nicola, Panio Giuseppe, di Dato Carla, Pofi Riccardo, Pozza Carlotta, Sbardella Emilia, Carbone Iacopo, Naro Fabio, Lenzi Andrea, Venneri Mary A, Isidori Andrea M J Clin Endocrinol Metab IF: 5.4 0000-00-00

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2