MIR26B (microRNA 26b)

symbol:
MIR26B
locus group:
non-coding RNA
location:
2q35
gene_family:
MicroRNAs
alias symbol:
hsa-mir-26b
alias name:
None
entrez id:
407017
ensembl gene id:
ENSG00000199121
ucsc gene id:
uc010zkd.3
refseq accession:
NR_029500
hgnc_id:
HGNC:31612
approved reserved:
2004-04-23
2q35
ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Nucleotide sequence of MIR26B:[NCBI]
Loading Gene Browser...
SNP variants of MIR26B:           Showing partial SNPs
rs695873       rs2227248       rs2227249       rs2227250       rs2227251       rs2227252       rs2227253       rs2227254       rs2227255       rs2227256       rs2227257       rs2227258       rs2252235       rs2607726       rs2607727       rs3795985       rs60755520      

Tissue expression of MIR26B:    [UniProt]

Gene expression across tissues
Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
GACCCAGTTCAAGTAATTCAGG
59
CCAAGTAATGGAGAACAGGC
59
CCAGTTCAAGTAATTCAGGATAGG
59
GAGCCAAGTAATGGAGAACAG
59
CCCAGTTCAAGTAATTCAGGA
58
AGCCAAGTAATGGAGAACAG
58
      No data available

Subcellular localization of MIR26B (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR26B:

microRNAs potentially regulating MIR26B:     

Loading…
Interacting Gene Interaction Source/Score
Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Precancerous Conditions 0.12 1 0 CTD_human
Liver Neoplasms, Experimental 0.12 1 0 CTD_human
Colorectal Neoplasms 0.12 1 0 CTD_human
Malignant neoplasm of ovary 0.002367032 1 0 GAD
Schizophrenia 0.002367032 1 0 GAD
Malignant neoplasm of breast 0.000814326 3 0 BeFree
Obesity 0.000814326 3 0 BeFree
Breast Carcinoma 0.000814326 3 0 BeFree
Osteosarcoma of bone 0.000542884 2 0 BeFree
Colorectal Carcinoma 0.000542884 2 0 BeFree
Two Different Serum MiRNA Signatures Correlate with the Clinical Outcome and Histological Subtype in Pleural Malignant Mesothelioma Patients.
Lamberti Monica, Capasso Rosanna, Lombardi Angela, Di Domenico Marina, Fiorelli Alfonso, Feola Antonia, Perna Alessandra F, Santini Mario, Caraglia Michele, Ingrosso Diego PLoS One IF: 2.6 2016-05-10
Annexin-A1 regulates microRNA-26b* and microRNA-562 to directly target NF-κB and angiogenesis in breast cancer cells.
Anbalagan Durkeshwari, Yap Gracemary, Yuan Yi, Pandey Vijay K, Lau Wai Hoe, Arora Suruchi, Bist Pradeep, Wong Justin S B, Sethi Gautam, Nissom Peter M, Lobie Peter E, Lim Lina H K PLoS One IF: 2.6 2015-08-18
MicroRNA-26b represses colon cancer cell proliferation by inhibiting lymphoid enhancer factor 1 expression.
Zhang Zichao, Kim KyoungHyun, Li Xiao, Moreno Myriam, Sharp Thad, Goodheart Michael J, Safe Stephen, Dupuy Adam J, Amendt Brad A Mol Cancer Ther IF: 6.9 2015-04-20
MicroRNA-26a/b regulate DNA replication licensing, tumorigenesis, and prognosis by targeting CDC6 in lung cancer.
Zhang Xin, Xiao Dakai, Wang Ziyi, Zou Yongxin, Huang Liyan, Lin Weixuan, Deng Qiuhua, Pan Hui, Zhou Jiangfen, Liang Chun, He Jianxing Mol Cancer Res IF: 5.8 2015-07-22
MicroRNAs-novel therapeutic targets of eicosanoid signalling.
Ochs Meike J, Steinhilber Dieter, Suess Beatrix Basic Clin Pharmacol Toxicol IF: 3.6 2014-08-05
Circulating miRNA is a novel marker for head and neck squamous cell carcinoma.
Hsu Cheng-Ming, Lin Pai-Mei, Wang Yu-Ming, Chen Zong-Jyun, Lin Sheng-Fung, Yang Ming-Yu Tumour Biol IF: 3.650 2013-01-31
Dysregulated microRNAs affect pathways and targets of biologic relevance in nasal-type natural killer/T-cell lymphoma.
Ng Siok-Bian, Yan Junli, Huang Gaofeng, Selvarajan Viknesvaran, Tay Jim Liang-Seah, Lin Baohong, Bi Chonglei, Tan Joy, Kwong Yok-Lam, Shimizu Norio, Aozasa Katsuyuki, Chng Wee-Joo Blood IF: 23.9 2012-01-09
Integrated microRNA and mRNA expression profiling in a rat colon carcinogenesis model: effect of a chemo-protective diet.
Shah Manasvi S, Schwartz Scott L, Zhao Chen, Davidson Laurie A, Zhou Beiyan, Lupton Joanne R, Ivanov Ivan, Chapkin Robert S Physiol Genomics IF: 2.5 2011-10-18
Evaluating the forensic application of 19 target microRNAs as biomarkers in body fluid and tissue identification.
Sirker M, Fimmers R, Schneider P M, Gomes I Forensic Sci Int Genet IF: 3.6 0000-00-00

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]