MIR27B (microRNA 27b)

Gene Basic Information

Gene Basic Information

symbol:
MIR27B
locus group:
non-coding RNA
location:
9q22.32
gene_family:
MicroRNAs
alias symbol:
hsa-mir-27b|MIR-27b
alias name:
None
entrez id:
407019
ensembl gene id:
ENSG00000207864
ucsc gene id:
uc064uma.1
refseq accession:
NR_029665
hgnc_id:
HGNC:31614
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

9q22.32

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR27B     Wikipedia entry for MIR27B

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR27B:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR27B:           Showing partial SNPs
rs1011784       rs3802448       rs3802449       rs4743988       rs7874388       rs28626189       rs55838201       rs57232080       rs59274098       rs62581075       rs73654510       rs73654511       rs75439956       rs75919092       rs111914249       rs114204390       rs115795725      

Gene Expression

Gene Expression

Tissue expression of MIR27B:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
CTCTAACAAGGTGCAGAGC
58
GTGAACAAAGCGGAAACCA
59
AACAGTGATTGGTTTCCGC
59
TCACCTTCTCTTCAGGTGC
59
TGAACAGTGATTGGTTTCCG
59
ACCTTCTCTTCAGGTGCAG
59

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR27B (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR27B:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR27B:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Drug-Induced Liver Injury 0.12 1 0 CTD_human
Cholestasis 0.12 1 0 CTD_human
Myocardial Reperfusion Injury 0.12 1 0 CTD_human
Atherosclerosis 0.000542884 2 0 BeFree
Hyperlipidemia 0.000542884 2 0 BeFree
Ovarian Carcinoma 0.000542884 2 0 BeFree
Arteriosclerosis 0.000542884 2 0 BeFree
Tumor Progression 0.000542884 2 0 BeFree
Diabetes Mellitus, Non-Insulin-Dependent 0.000542884 2 0 BeFree
Breast Carcinoma 0.000542884 2 0 BeFree

Related Publications

Related Publications

CCL18-mediated down-regulation of miR98 and miR27b promotes breast cancer metastasis.
Lin Xiaorong, Chen Lijun, Yao Yandang, Zhao Ruihua, Cui Xiuying, Chen Jun, Hou Kailian, Zhang Mingxia, Su Fengxi, Chen Jingqi, Song Erwei Oncotarget IF: 5.168 2016-07-13
Interleukin-6 mediated upregulation of CYP1B1 and CYP2E1 in colorectal cancer involves DNA methylation, miR27b and STAT3.
Patel S A A, Bhambra U, Charalambous M P, David R M, Edwards R J, Lightfoot T, Boobis A R, Gooderham N J Br J Cancer IF: 7.8 2015-04-16
Fumonisin B₁ modulates expression of human cytochrome P450 1b1 in human hepatoma (Hepg2) cells by repressing Mir-27b.
Chuturgoon Anil A, Phulukdaree Alisa, Moodley Devapregasan Toxicol Lett IF: 3.1 2014-06-17
Integrated microRNA and mRNA expression profiling in a rat colon carcinogenesis model: effect of a chemo-protective diet.
Shah Manasvi S, Schwartz Scott L, Zhao Chen, Davidson Laurie A, Zhou Beiyan, Lupton Joanne R, Ivanov Ivan, Chapkin Robert S Physiol Genomics IF: 2.5 2011-10-18
Adenosine 2B receptor expression is post-transcriptionally regulated by microRNA.
Kolachala Vasantha L, Wang Lixin, Obertone Tracy S, Prasad Meena, Yan Yutao, Dalmasso Guillaume, Gewirtz Andrew T, Merlin Didier, Sitaraman Shanthi V J Biol Chem IF: 4.1 2010-06-29
Coding and noncoding expression patterns associated with rare obesity-related disorders: Prader-Willi and Alström syndromes.
Butler Merlin G, Wang Kun, Marshall Jan D, Naggert Jürgen K, Rethmeyer Jasmine A, Gunewardena Sumedha S, Manzardo Ann M Adv Genomics Genet 0000-00-00
Increased Wnt5a in squamous cell lung carcinoma inhibits endothelial cell motility.
Rapp J, Kiss E, Meggyes M, Szabo-Meleg E, Feller D, Smuk G, Laszlo T, Sarosi V, Molnar T F, Kvell K, Pongracz J E BMC Cancer IF: 3.288 0000-00-00

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2