MIR34A (microRNA 34a)

Gene Basic Information

Gene Basic Information

symbol:
MIR34A
locus group:
non-coding RNA
location:
1p36.22
gene_family:
MicroRNAs
alias symbol:
hsa-mir-34a
alias name:
None
entrez id:
407040
ensembl gene id:
ENSG00000284357
ucsc gene id:
uc021ofw.1
refseq accession:
NR_029610
hgnc_id:
HGNC:31635
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

1p36.22

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR34A     Wikipedia entry for MIR34A

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR34A:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR34A:           Showing partial SNPs
rs2666433       rs6577554       rs6577555       rs9729651       rs12128240       rs35301225       rs59795837       rs70985597       rs71580072       rs71641076       rs72631823       rs72865538       rs76036075       rs76571374       rs77585961       rs78093734       rs78621059      

Gene Expression

Gene Expression

Tissue expression of MIR34A:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
TGTGAGTGTTTCTTTGGCAG
59
GATTGCTTCCTTACTATTGCTC
57
TTCTTTGGCAGTGTCTTAGC
59
ATACTTGCTGATTGCTTCCT
57
TGAGTGTTTCTTTGGCAGTG
59
CTGATTGCTTCCTTACTATTGC
58

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR34A (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR34A:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR34A:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Fatty Liver 0.120271442 2 0 BeFree_CTD_human
Obesity 0.12 1 0 CTD_human
Impaired glucose tolerance 0.12 1 0 CTD_human
Inflammation 0.12 1 0 CTD_human
Liver Neoplasms, Experimental 0.12 1 0 CTD_human
Heart Diseases 0.12 1 0 CTD_human
Carcinogenesis 0.003257302 12 0 BeFree
Stomach Carcinoma 0.002442977 9 0 BeFree
Malignant neoplasm of stomach 0.002442977 9 0 BeFree
Glioma 0.002442977 9 0 BeFree

Related Publications

Related Publications

ERK promotes miR34a/ISOC1 signaling to enhance all trans retinoic acid-induced myeloid differentiation in acute promyelocytic leukemia.
Zhang Y, Li Y, Li N, Zou C, Liu C, Zhang X, Ding X, Cao R, Liu L, Ran X, Lin Z, Su W J Biol Chem 2026-08-00
Myeloid Mir34a suppresses initiation and progression of intestinal and colitis-induced colon cancers in APCmin mice.
Chen Y, Liu F, König J, Bouznad N, Hermeking H Cell Death Dis IF: 12.2 2026-05-15
Potential biomarkers of Ewing sarcoma identified through a Europe-wide analysis of prospectively collected samples.
Ranft A, Richter GHS, Diaz-Martin J, Jabar S, Jens M, Kerkhoff M, Blanquer-Maceiras M, Noguera R, Piro I, Steiger K, Burdach S, Parra A, Picci P, Gambarotti M, Hartmann W, Scotlandi K, de Alava E, Dirksen U Sci Rep IF: 4.9 2026-04-07
Cationic Lipid Nanoparticles for miR-34A Delivery to Lung Cancer Cells: Comparative Evaluation of Plasmid DNA and Oligonucleotide Formulations.
Kotmakci M, Duzgun Z, Karagoz U, Bozok V, Kantarci AG Curr Pharm Biotechnol IF: 2.9 2026-07-13
Targeted Delivery of miR-34a via Anti-CD47 Antibody Conjugates for Enhanced Cancer Immunotherapy in Triple Negative Breast Cancer.
Ryu Y, Kim EH, Jang H, Kim Y, Park B, Choi J, Jang Y, Chi SG, Shim MK, Kim SH, Yoon HY, Yang Y Small IF: 11.8 2025-09-00
Role of miRNA in diagnosis of Wilms tumor and neuroblastoma.
Kakkar D, Mallick S, Ahmad A, Goswami A, Agarwala S, Gupta AK, Bakhshi S, Devasenathipathy K, Mathur S, Prasad J, Jain D, Seth R, Iyer VK Indian J Cancer IF: 0.8 2025-10-01
Strong Association Between MiRNA Gene Variants and Type 2 Diabetes Mellitus in a Caucasian Population.
Manthou E, Tsekmekidou X, Tsetsos F, Koufakis T, Grammatiki M, Rakintzi P, Melidou E, Karaliolios G, Paschou P, Papanas N, Kotsa K Int J Mol Sci IF: 3.226 2025-10-28

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2