MIR449A (microRNA 449a)

symbol
MIR449A
locus group
non-coding RNA
location
5q11.2
gene_family
MicroRNAs
alias symbol
hsa-mir-449|hsa-mir-449a
alias name
None
entrez id
554213
ensembl gene id
ENSG00000198983
ucsc gene id
uc011cqh.2
refseq accession
NR_029960
hgnc_id
HGNC:27645
approved reserved
2005-05-24
5q11.2
ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Nucleotide sequence of MIR449A:[NCBI]
Loading Gene Browser...
SNP variants of MIR449A:           Showing partial SNPs
rs193105       rs7712791       rs7713889       rs7727157       rs10061133       rs35770269       rs62360415       rs75661995       rs79459970       rs80128065       rs111416873       rs112310158       rs112705432       rs113400974       rs137940833       rs138334673       rs138811807      
Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
CTGGCAGTGTATTGTTAGCTG
59
CAGCAGTTGCATGTTAGCC
60
CTGGCAGTGTATTGTTAGCT
58
CAGCAGTTGCATGTTAGCC
60
TGGCAGTGTATTGTTAGCTG
58
ACAGCAGTTGCATGTTAGC
59
Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Carcinoma of lung 0.001085767 4 0 BeFree
Malignant neoplasm of lung 0.001085767 4 0 BeFree
Liver carcinoma 0.000542884 2 0 BeFree
Neuroblastoma 0.000271442 1 0 BeFree
Multiple tumors 0.000271442 1 0 BeFree
Endometrial Carcinoma 0.000271442 1 0 BeFree
cancer recurrence 0.000271442 1 0 BeFree
Carcinoma of bladder 0.000271442 1 0 BeFree
leukemia 0.000271442 1 0 BeFree
Carcinogenesis 0.000271442 1 0 BeFree
Degradative autophagy regulates the homeostasis of miRnas to control cancer development.
Wu SY, Chu CA, Lan SH, Liu HS Autophagy IF: 18.6 2024-00-00
Tissue expression of miR-449a as risk factor for occult neck metastasis in patients with cT3-T4 N0 laryngeal cancer. A pilot study.
Ricciardiello F, Falco M, Scarpa A, Motta G, Viola P, Bocchetti M, Caraglia M, Alfieri N, Oliva F, Tammaro C, Tortoriello G, Radici M, Camaioni A, Misso G, De Luca P Eur Arch Otorhinolaryngol IF: 2.4 2024-09-00
[Characteristics and regulatory mechanisms of lipid metabolism remodeling after malignant transformation of glioma-associated macrophages].
Sheng YJ, Jiang QQ, Liu L, Cheng S, Li HR, Li SW, Huang SL, Li YD, Yuan JQ, Ping YF, Dong J Zhonghua Yi Xue Za Zhi 2022-10-25
Dasatinib plus quercetin prevents uterine age-related dysfunction and fibrosis in mice.
Cavalcante MB, Saccon TD, Nunes ADC, Kirkland JL, Tchkonia T, Schneider A, Masternak MM Aging (Albany NY) IF: 3.9 2020-00-18
Hot Spot TERT Promoter Mutations Are Rare in Sporadic Pancreatic Neuroendocrine Neoplasms and Associated with Telomere Length and Epigenetic Expression Patterns.
Posch A, Hofer-Zeni S, Klieser E, Primavesi F, Naderlinger E, Brandstetter A, Filipits M, Urbas R, Swiercynski S, Jäger T, Winkelmann P, Kiesslich T, Lu L, Neureiter D, Stättner S, Holzmann K Cancers (Basel) 2020-06-19
Three isoforms of exosomal circPTGR1 promote hepatocellular carcinoma metastasis via the miR449a-MET pathway.
Wang G, Liu W, Zou Y, Wang G, Deng Y, Luo J, Zhang Y, Li H, Zhang Q, Yang Y, Chen G EBioMedicine IF: 11.2 2019-02-00
Single nucleotide polymorphism rs696 in miR449a binding site of NFKBIA gene is correlated with risk of colorectal cancer.
Simonian M, Mosallayi M, Miraghajani M, Feizi A, Khosravi S, Salehi AR, Mortazavi D, Saberi F, Salehi R Gastroenterol Hepatol Bed Bench 2018-00-00
Identification of potential key genes associated with severe pneumonia using mRNA-seq.
Feng C, Huang H, Huang S, Zhai YZ, Dong J, Chen L, Huang Z, Zhou X, Li B, Wang LL, Chen W, Lv FQ, Li TS Exp Ther Med IF: 2.2 2018-08-00
Loss of miR-449a-caused PrLZ overexpression promotes prostate cancer metastasis.
Chen W, Liu Y, Chen H, Ning H, Ding K Int J Oncol IF: 7.3 2017-08-00

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]