MIR492 (microRNA 492)

Gene Basic Information

Gene Basic Information

symbol:
MIR492
locus group:
non-coding RNA
location:
12q22
gene_family:
MicroRNAs
alias symbol:
hsa-mir-492
alias name:
None
entrez id:
574449
ensembl gene id:
ENSG00000283998
ucsc gene id:
uc001tdk.3
refseq accession:
NR_030171
hgnc_id:
HGNC:32081
approved reserved:
2005-07-15

Chromosome Location

Chromosome Location

12q22

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR492     Wikipedia entry for MIR492

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR492:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR492:           Showing partial SNPs
rs2289029       rs2289030       rs2289031       rs6538554       rs10745704       rs11107743       rs11107744       rs11833051       rs12099816       rs55788968       rs58517159       rs74479789       rs75909841       rs76416051       rs77639545       rs111973366       rs116621780      

Gene Expression

Gene Expression

Tissue expression of MIR492:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
GGACAAGATTCTTGGTGCC
59
AGCATTGTTGATCTGCAGG
59
GACAAGATTCTTGGTGCCAC
60
GAGCATTGTTGATCTGCAGG
60
GGGACAAGATTCTTGGTGC
59
GCATTGTTGATCTGCAGGA
59

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR492 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR492:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR492:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Renal Cell Carcinoma 0.002367032 1 0 GAD
Kidney Neoplasm 0.002367032 1 0 GAD
Malignant neoplasm of esophagus 0.002367032 1 0 GAD
Neoplasm Recurrence, Local 0.002367032 1 0 GAD
Malignant neoplasm of breast 0.000542884 2 0 BeFree
Breast Carcinoma 0.000542884 2 0 BeFree
Malignant tumor of colon 0.000542884 2 0 BeFree
Psoriasis 0.000271442 1 1 BeFree
Prostatic Neoplasms 0.000271442 1 0 BeFree
Endothelial dysfunction 0.000271442 1 0 BeFree

Related Publications

Related Publications

Effect of BRAF mutational status on expression profiles in conventional papillary thyroid carcinomas.
Schulten Hans-Juergen, Alotibi Reem, Al-Ahmadi Alaa, Ata Manar, Karim Sajjad, Huwait Etimad, Gari Mamdooh, Al-Ghamdi Khalid, Al-Mashat Faisal, Al-Hamour Osman, Al-Qahtani Mohammad Hussain, Al-Maghrabi Jaudah BMC Genomics IF: 3.9 2016-01-28
Upregulation of microRNA-492 induced by epigenetic drug treatment inhibits the malignant phenotype of clear cell renal cell carcinoma in vitro.
Wu Aibing, Wu Kunpeng, Li Mingchun, Bao Lingli, Shen Xiang, Li Shunjun, Li Jinmei, Yang Zhixiong Mol Med Rep IF: 5.0 2016-01-15
Potentially prognostic miRNAs in HPV-associated oropharyngeal carcinoma.
Hui Angela B Y, Lin Alice, Xu Wei, Waldron Levi, Perez-Ordonez Bayardo, Weinreb Ilan, Shi Wei, Bruce Jeff, Huang Shao Hui, O'Sullivan Brian, Waldron John, Gullane Patrick, Irish Jonathan C, Chan Kelvin, Liu Fei-Fei Clin Cancer Res IF: 10.9 2013-11-11
Prognostic impact of microRNA-related gene polymorphisms on survival of patients with colorectal cancer.
Lee Hyun-Chul, Kim Jong Gwang, Chae Yee Soo, Sohn Sang Kyun, Kang Byung Woog, Moon Joon Ho, Jeon Seong Woo, Lee Myung-Hoon, Lim Kyoung-Hoon, Park Jin Young, Choi Gyu Seog, Jun Soo-Han J Cancer Res Clin Oncol IF: 3.3 2010-06-17

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2