MIR9-1 (microRNA 9-1)

Gene Basic Information

Gene Basic Information

symbol:
MIR9-1
locus group:
non-coding RNA
location:
1q22
gene_family:
MicroRNAs
alias symbol:
hsa-mir-9-1
alias name:
None
entrez id:
407046
ensembl gene id:
ENSG00000207933
ucsc gene id:
uc057lzy.1
refseq accession:
NR_029691
hgnc_id:
HGNC:31641
approved reserved:
2004-04-23

Chromosome Location

Chromosome Location

1q22

Gene Summary

Gene Summary

ChineseEnglish

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

OMIM entry for MIR9-1     Wikipedia entry for MIR9-1

Gene Sequence

Gene Sequence

Nucleotide sequence of MIR9-1:[NCBI]
Loading Gene Browser...

Gene Variants

Gene Variants

SNP variants of MIR9-1:           Showing partial SNPs
rs12123291       rs12239077       rs12405839       rs12405840       rs59104372       rs72710250       rs72710252       rs72994612       rs74960774       rs112276358       rs112487499       rs113486968       rs116416891       rs138776627       rs140192163       rs147499136       rs149408558      

Gene Expression

Gene Expression

Tissue expression of MIR9-1:    [UniProt]

Gene expression across tissues

Gene Primers

Gene Primers

Forward Primer
Forward Tm
Reverse Primer
Reverse Tm
Score
CTAGCTTTATGAAGACTCCACAC
59
GGGTTGGTTGTTATCTTTGGT
59
TAGCTTTATGAAGACTCCACAC
58
GGGTTGGTTGTTATCTTTGGT
59
TAGCTTTATGAAGACTCCACAC
58
GGGTTGGTTGTTATCTTTGG
57

Transcription Factors

Transcription Factors

      No data available

Gene Ontology

Subcellular localization of MIR9-1 (and its protein):

[UniProt]     [GenomeNet]

" d="M482.414,245.296c3.539,4.293,4.455,10.009,0.202,11 c-4.244,0.996-4.983-10.983-8.293-8.438c-5.271,4.08,9.834,12.271,5.144,17.287c-3.717,3.607-6.172-5.75-10.839-1.976 c-4.673,3.776,6.781,7.299,2.831,11.326c-4.354,4.045-6.979-1.449-9.837-5.517c-1.193-1.742-2.059-3.851-3.595-2.748 c-1.516,1.078-1.854,1.795-0.938,3.666c2.374,4.854,9.235,10.119,5.156,12.535c-5.636,3.346-5.044-8.871-9.426-7.574 c-4.388,1.291,2.557,10.66-1.245,11.141c-4.089,0.545-3.483-10.239-6.979-8.575c-2.522,1.206-0.929,3.071-0.938,4.899 c0.004,1.32-0.964,3.6-2.372,4.062c-3.593,1.171-8.544-1.065-10.251-3.59c-6.04-8.93,0.396-15.997,4.639-7.015 c3.023,4.642,5.182,0.834,2.839-2.219c-1.032-1.354-4.309-5.901-0.781-7.252c2.904-1.113,4.271,1.941,5.985,4.592 c2.61,4.016,5.485,0.117,3.031-3.414c-1.828-2.633-2.74-3.803,3.156-7.42c6.405-4.369,6.52,3.869,10.077,0.646 c2.309-1.832-4.783-5.149,0.06-8.995c2.896-2.293,5.18,6.207,7.961,3.516c3.523-2.737-7.717-7.369,0.117-11.736 C473.413,240.77,480.519,242.891,482.414,245.296z"/> Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
  • plasma membrane
  • cytoplasm
  • extracellular
  • golgi
  • vesicle
  • cytoskeleton
  • endoplasmic reticulum
  • nucleus
  • endosome
  • lysosome
  • mitochondrion

Gene Ontology (GO) terms for MIR9-1:

Related microRNA

Related microRNA

microRNAs potentially regulating MIR9-1:     

Gene Interactions

Gene Interactions

Loading…
Interacting Gene Interaction Source/Score

Gene Pathways

Gene Pathways

Related Diseases

Related Diseases

Disease Score NofPmids NofSnps Source
Disease Score NofPmids NofSnps Source
Neurobehavioral Manifestations 0.12 1 0 CTD_human
Malignant neoplasm of ovary 0.002367032 1 0 GAD
Malignant neoplasm of breast 0.000542884 2 0 BeFree
Breast Carcinoma 0.000542884 2 0 BeFree
Conventional (Clear Cell) Renal Cell Carcinoma 0.000271442 1 0 BeFree
Squamous cell carcinoma of the head and neck 0.000271442 1 0 BeFree
Secondary malignant neoplasm of lymph node 0.000271442 1 0 BeFree
Oropharyngeal disorders 0.000271442 1 0 BeFree
Multiple Myeloma 0.000271442 1 0 BeFree
Stomach Carcinoma 0.000271442 1 0 BeFree

Related Publications

Related Publications

Investigation of miR9-1, miR9-2 and miR9-3 Methylation in Hodgkin Lymphoma.
Ben Dhiab Myriam, Ziadi Sonia, Louhichi Teheni, Ben Gacem Riadh, Ksiaa Feryel, Trimeche Mounir Pathobiology IF: 1.7 2016-07-11
Analyzing the Role of MicroRNAs in Schizophrenia in the Context of Common Genetic Risk Variants.
Hauberg Mads Engel, Roussos Panos, Grove Jakob, Børglum Anders Dupont, Mattheisen Manuel, JAMA Psychiatry IF: 18.0 2016-08-22
Investigation of Dysregulation of Several MicroRNAs in Peripheral Blood of Schizophrenia Patients.
Camkurt Mehmet Akif, Karababa Fatih, Erdal Mehmet Emin, Bayazıt Hüseyin, Kandemir Sultan Basmacı, Ay Mustafa Ertan, Kandemir Hasan, Ay Özlem İzci, Çiçek Erdinç, Selek Salih, Taşdelen Bahar Clin Psychopharmacol Neurosci IF: 3.4 2016-08-04
Deregulation of FGFR1 and CDK6 oncogenic pathways in acute lymphoblastic leukaemia harbouring epigenetic modifications of the MIR9 family.
Rodriguez-Otero Paula, Román-Gómez José, Vilas-Zornoza Amaia, José-Eneriz Edurne San, Martín-Palanco Vanesa, Rifón José, Torres Antonio, Calasanz María José, Agirre Xabier, Prosper Felipe Br J Haematol IF: 3.6 2014-05-09
Critical role of miR-9 in myelopoiesis and EVI1-induced leukemogenesis.
Senyuk Vitalyi, Zhang Yunyuan, Liu Yang, Ming Ming, Premanand Kavitha, Zhou Lan, Chen Ping, Chen Jianjun, Rowley Janet D, Nucifora Giuseppina, Qian Zhijian Proc Natl Acad Sci U S A IF: 9.5 2013-06-11
Bioimaging of the unbalanced expression of microRNA9 and microRNA9* during the neuronal differentiation of P19 cells.
Ko Mee Hyang, Kim Soonhag, Hwang Do Won, Ko Hae Young, Kim Young Ha, Lee Dong Soo FEBS J IF: 4.2 2008-07-18
Differential DNA Methylation of MicroRNA Genes in Temporal Cortex from Alzheimer's Disease Individuals.
Villela Darine, Ramalho Rodrigo F, Silva Aderbal R T, Brentani Helena, Suemoto Claudia K, Pasqualucci Carlos Augusto, Grinberg Lea T, Krepischi Ana C V, Rosenberg Carla Neural Plast IF: 3.4 0000-00-00

Related Services

Related Services

Comments

Comments

Loading comments...

Log in to post comments Log In Sign Up

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2