Home LiteratureArticle Details
PMID: 3022280 Published · ppublish English Journal Article Research Support, Non-U.S. Gov't

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

Proceedings of the National Academy of Sciences of the United States of America ·Vol. 83 ·No. 21 ·1986-11-00 ·Pages 8112-6

Shimotohno K, Takano M, Teruuchi T, Miwa M

Abstract

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

MeSH Terms
Acetyltransferases/genetics Cell Line Chloramphenicol O-Acetyltransferase Deltaretrovirus/genetics Enhancer Elements, Genetic Genes, Viral Repetitive Sequences, Nucleic Acid Transcription, Genetic
Chemicals
Acetyltransferases Chloramphenicol O-Acetyltransferase
Authors & Affiliations
4 authors, click to expand affiliations / ORCID
Shimotohno K
Takano M
Teruuchi T
Miwa M
References (38)
38 references, click to expand
  1. Identification of the gene responsible for human T-cell leukaemia virus transcriptional regulation.
    Nature. 1985 Dec 12-18;318(6046):571-4 PMID: 2999613
  2. Location of cis-acting regulatory sequences in the human T-cell leukemia virus type I long terminal repeat.
    Proc Natl Acad Sci U S A. 1985 Oct;82(19):6502-6 PMID: 2995968
  3. p27x-III and p21x-III, proteins encoded by the pX sequence of human T-cell leukemia virus type I.
    Proc Natl Acad Sci U S A. 1985 Dec;82(24):8359-63 PMID: 3001699
  4. The p40x of human T-cell leukemia virus type I is a trans-acting activator of viral gene transcription.
    Jpn J Cancer Res. 1985 Dec;76(12):1127-31 PMID: 3005203
  5. Activation of enhancer sequences in type II human T-cell leukemia virus and bovine leukemia virus long terminal repeats by virus-associated trans-acting regulatory factors.
    J Virol. 1986 Mar;57(3):738-44 PMID: 3005624
  6. Two elements in the bovine leukemia virus long terminal repeat that regulate gene expression.
    Science. 1986 Mar 21;231(4744):1437-40 PMID: 3006241
  7. Multiple sequence motifs are involved in SV40 enhancer function.
    EMBO J. 1986 Feb;5(2):387-97 PMID: 3011406
  8. A transcriptional enhancer sequence of HTLV-I is responsible for trans-activation mediated by p40 chi HTLV-I.
    EMBO J. 1986 Apr;5(4):713-8 PMID: 3011423
  9. A new technique for the assay of infectivity of human adenovirus 5 DNA.
    Virology. 1973 Apr;52(2):456-67 PMID: 4705382
  10. Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukaemic T cells.
    Nature. 1981 Dec 24;294(5843):770-1 PMID: 6275274
  11. Activation of SV40 genome by 72-base pair tandem repeats of Moloney sarcoma virus.
    Nature. 1982 Feb 18;295(5850):568-72 PMID: 6276775
  12. Transformation of human leukocytes by cocultivation with an adult T cell leukemia virus producer cell line.
    Science. 1982 Aug 20;217(4561):737-9 PMID: 6980467
  13. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
    Mol Cell Biol. 1982 Sep;2(9):1044-51 PMID: 6960240
  14. The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNA-mediated transfection.
    Proc Natl Acad Sci U S A. 1982 Nov;79(22):6777-81 PMID: 6294651
  15. Isolation and transmission of human retrovirus (human t-cell leukemia virus).
    Science. 1983 Feb 18;219(4586):856-9 PMID: 6600519
  16. Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA.
    Proc Natl Acad Sci U S A. 1983 Jun;80(12):3618-22 PMID: 6304725
  17. The adenovirus type 5 E1A transcriptional control region contains a duplicated enhancer element.
    Cell. 1983 Jul;33(3):695-703 PMID: 6871991
  18. Location and function of retroviral and SV40 sequences that enhance biochemical transformation after microinjection of DNA.
    Cell. 1983 Jul;33(3):705-16 PMID: 6307525
  19. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes.
    Cell. 1983 Jul;33(3):729-40 PMID: 6409418
  20. Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia.
    Proc Natl Acad Sci U S A. 1983 Oct;80(19):6061-5 PMID: 6193528
  21. Human T-cell leukemia virus type II transforms normal human lymphocytes.
    Proc Natl Acad Sci U S A. 1983 Nov;80(22):7006-9 PMID: 6316341
  22. Nucleotide sequence analysis of the long terminal repeat of human T-cell leukemia virus type II.
    Proc Natl Acad Sci U S A. 1984 Feb;81(4):1079-83 PMID: 6322188
  23. Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells.
    Science. 1984 Jul 27;225(4660):381-5 PMID: 6330891
  24. Repetitive structure in the long-terminal-repeat element of a type II human T-cell leukemia virus.
    Proc Natl Acad Sci U S A. 1984 Aug;81(15):4617-21 PMID: 6087335
  25. Antigens encoded by the 3'-terminal region of human T-cell leukemia virus: evidence for a functional gene.
    Science. 1984 Oct 5;226(4670):57-61 PMID: 6089350
  26. Identification of the putative transforming protein of the human T-cell leukemia viruses HTLV-I and HTLV-II.
    Science. 1984 Oct 5;226(4670):61-5 PMID: 6089351
  27. Identification of a protein (p40x) encoded by a unique sequence pX of human T-cell leukemia virus type I.
    Gan. 1984 Sep;75(9):747-51 PMID: 6094295
  28. Detection of pX proteins in human T-cell leukemia virus (HTLV)-infected cells by using antibody against peptide deduced from sequences of X-IV DNA of HTLV-I and Xc DNA of HTLV-II proviruses.
    Gan. 1984 Sep;75(9):752-5 PMID: 6094296
  29. Bovine leukemia virus long terminal repeat: a cell type-specific promoter.
    Science. 1985 Jan 18;227(4684):317-20 PMID: 2981431
  30. Trans activation of the bovine leukemia virus long terminal repeat in BLV-infected cells.
    Science. 1985 Jan 18;227(4684):320-2 PMID: 2981432
  31. Long terminal repeat structure of an American isolate of type I human T-cell leukemia virus.
    Virology. 1984 Dec;139(2):340-5 PMID: 6097028
  32. Identification of new gene products coded from X regions of human T-cell leukemia viruses.
    Proc Natl Acad Sci U S A. 1985 Jan;82(2):302-6 PMID: 2982148
  33. Functional activation of the long terminal repeat of human T-cell leukemia virus type I by a trans-acting factor.
    Proc Natl Acad Sci U S A. 1985 Apr;82(8):2277-81 PMID: 2986109
  34. Complete nucleotide sequence of an infectious clone of human T-cell leukemia virus type II: an open reading frame for the protease gene.
    Proc Natl Acad Sci U S A. 1985 May;82(10):3101-5 PMID: 2582407
  35. A transcriptional activator protein encoded by the x-lor region of the human T-cell leukemia virus.
    Science. 1985 Jun 21;228(4706):1430-4 PMID: 2990028
  36. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats.
    Science. 1985 Aug 16;229(4714):675-9 PMID: 2992082
  37. Sequence homologies in the control regions of c-myc, c-fos, HTLV and the interleukin-2 receptor.
    Cancer Lett. 1985 Aug;28(1):69-76 PMID: 2992763
  38. Requirement of stereospecific alignments for initiation from the simian virus 40 early promoter.
    Nature. 1986 Jan 9-15;319(6049):121-6 PMID: 3001535
Article Info
Journal
Proceedings of the National Academy of Sciences of the United States of America
Abbr.
Proc Natl Acad Sci U S A
ISSN
0027-8424
DOI
10.1073/pnas.83.21.8112
Published
1986-11-00
Pages
8112-6
Language
English
Region
United States
NLM ID
7505876
PMCID
PMC386877
Subset
IM
External Links
PubMed source DOI: 10.1073/pnas.83.21.8112 PMC Full Text View journal details
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2