The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong
Qilu Normal University · Genelibs Bioinformatics Lab
750 Shunhua Rd, Jinan
2F, Bldg F, University Science Park
Tel: 0531-88819269
Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.
Business Email
E-mail: [email protected]