The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.
No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong
Qilu Normal University · Genelibs Bioinformatics Lab
750 Shunhua Rd, Jinan
2F, Bldg F, University Science Park
Tel: 0531-88819269
Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.
Business Email
E-mail: [email protected]