Home LiteratureArticle Details
PMID: 7279661 Published · ppublish English Journal Article Research Support, U.S. Gov't, Non-P.H.S. Research Support, U.S. Gov't, P.H.S.

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Nucleic acids research ·Vol. 9 ·No. 12 ·1981-06-25 ·Pages 2801-5

Delihas N, Andersen J, Sprouse HM, Dudock B

Abstract

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

MeSH Terms
Base Sequence Chloroplasts/analysis Nucleic Acid Conformation Plants/analysis RNA, Ribosomal
Chemicals
RNA, Ribosomal
Authors & Affiliations
4 authors, click to expand affiliations / ORCID
Delihas N
Andersen J
Sprouse H M
Dudock B
References (13)
13 references, click to expand
  1. Use of DNA polymerase I primed by a synthetic oligonucleotide to determine a nucleotide sequence in phage fl DNA.
    Proc Natl Acad Sci U S A. 1973 Apr;70(4):1209-13 PMID: 4577794
  2. The nucleotide sequence of 5 S rRNA from the blue-green alga Anacystis nidulans.
    FEBS Lett. 1974 Sep 15;46(1):63-6 PMID: 4371332
  3. 5S RNA secondary structure.
    Nature. 1975 Aug 7;256(5517):505-7 PMID: 808733
  4. Evidence for the nucleotide sequence of 5-S rRNA from the flowering plant Secale cereale (Rye).
    Eur J Biochem. 1976 Dec;71(1):33-8 PMID: 1009953
  5. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.
    Eur J Biochem. 1977 Feb;72(3):465-78 PMID: 402264
  6. Mapping adenines, guanines, and pyrimidines in RNA.
    Nucleic Acids Res. 1977 Aug;4(8):2527-38 PMID: 409999
  7. A different approach to RNA sequencing.
    Nature. 1978 Jul 6;274(5666):87-9 PMID: 662002
  8. Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plants.
    Biochem J. 1979 Dec 1;183(3):595-604 PMID: 540034
  9. Nucleotide sequence of a spinach chloroplast threonine tRNA.
    J Biol Chem. 1980 Sep 25;255(18):8831-5 PMID: 7410397
  10. The nucleotide sequence of a major species of leucine tRNA from bovine liver.
    Nucleic Acids Res. 1980 Feb 25;8(4):805-15 PMID: 6903884
  11. Homologies among ribosomal RNA and messenger RNA genes in chloroplasts, mitochondria and E. coli.
    Mol Gen Genet. 1980;179(3):539-45 PMID: 7003301
  12. Nucleotide sequences of wheat-embryo cytosol 5-S and 5.8-S ribosomal ribonucleic acids.
    Eur J Biochem. 1980 Dec;112(3):561-76 PMID: 6780349
  13. Collection of published 5S and 5.8S RNA sequences and their precursors.
    Nucleic Acids Res. 1981 Jan 10;9(1):r25-42 PMID: 7010308
Article Info
Journal
Nucleic acids research
Abbr.
Nucleic Acids Res
ISSN
0305-1048
Published
1981-06-25
Pages
2801-5
Language
English
Region
England
NLM ID
0411011
PMCID
PMC326894
Subset
IM
Grants
NIGMS NIH HHS · GM-20052 · United States
NIGMS NIH HHS · GM-25254 · United States
NCRR NIH HHS · RR-05736 · United States
Databases
GENBANK
V00169
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]