Samples：9 Organism：Mus musculus Type：transcription profiling by array March 29, 2014

...SYK) signaling in vivo. In diagnostic samples from human B-ALL patients, SYK and downstream targets were phosphorylated ...

Samples：6 Organism：Rattus norvegicus Type：transcription profiling by array March 27, 2014

...Syk inhibitor R406-pretreated cells in order to examine the importance of Syk for Dectin-1-mediated gene up-regulations.

Samples：20 Organism：Homo sapiens Type：transcription profiling by array Jan. 15, 2014

...SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone I...

Samples：29 Organism：Homo sapiens Type：transcription profiling by array Dec. 31, 2013

...SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from two DLBCL cell ...

Samples：75 Organism：Homo sapiens Type：transcription profiling by array Aug. 31, 2013

...SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from five DLBCL cell...

Samples：8 Organism：Mus musculus Type：transcription profiling by array May 22, 2013

Gene expression data from CD22+B220+ FACS-purified splenocytes of adult Sca1-HGAL knock-in CBAxC57BL/6J mice or wild-typ...

Samples：8 Organism：Mus musculus Type：transcription profiling by array April 24, 2013

...Syk as a critical mediator of Itgb3 activity in leukemia. Finally, we confirmed that Itgb3 is dispensable for normal hem...

Samples：24 Organism：Homo sapiens Type：transcription profiling by array April 24, 2013

...Syk.  In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation.  Finall...

Samples：12 Organism：Mus musculus Type：transcription profiling by array Nov. 15, 2012

...Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis. SmoA1 Tg...

Samples：10 Organism：Mus musculus Type：transcription profiling by array Oct. 2, 2012

...Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis. Bone mar...