Home LiteratureArticle Details
PMID: 6255437 Published · ppublish English Journal Article Research Support, U.S. Gov't, P.H.S.

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

Nucleic acids research ·Vol. 8 ·No. 21 ·1980-11-11 ·Pages 4899-910

Hershey ND, Davidson N

Abstract

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.

MeSH Terms
Animals Base Sequence Chromosome Mapping DNA Restriction Enzymes DNA, Recombinant Drosophila melanogaster/genetics Genes Glycine RNA, Transfer/genetics
Chemicals
DNA, Recombinant RNA, Transfer DNA Restriction Enzymes Glycine
Authors & Affiliations
2 authors, click to expand affiliations / ORCID
Hershey N D
Davidson N
References (30)
30 references, click to expand
  1. On the redundancy of DNA complementary to amino acid tranfer RNA and its absence from the nucleolar organizer region of Drosophila melanogaster.
    Genetics. 1966 Aug;54(2):663-76 PMID: 5968646
  2. The 5 s RNA genes of Drosophila melanogaster.
    J Mol Biol. 1970 Jul 28;51(2):171-83 PMID: 5485902
  3. Localization of tRNA genes in the salivary chromosomes of Drosophila by RNA:DNA hybridization.
    Genetics. 1971 Oct;69(2):163-78 PMID: 5002748
  4. Construction of biologically functional bacterial plasmids in vitro.
    Proc Natl Acad Sci U S A. 1973 Nov;70(11):3240-4 PMID: 4594039
  5. The localization of transfer RNA5Lys genes in Drosophila melanogaster.
    Proc Natl Acad Sci U S A. 1974 Sep;71(9):3527-31 PMID: 4215081
  6. Nucleotide sequence of the rightward operator of phage lambda.
    Proc Natl Acad Sci U S A. 1975 Mar;72(3):1184-8 PMID: 1055375
  7. Detection of specific sequences among DNA fragments separated by gel electrophoresis.
    J Mol Biol. 1975 Nov 5;98(3):503-17 PMID: 1195397
  8. Colony hybridization: a method for the isolation of cloned DNAs that contain a specific gene.
    Proc Natl Acad Sci U S A. 1975 Oct;72(10):3961-5 PMID: 1105573
  9. Base sequence complexity of the stable RNA species of Drosophila melanogaster.
    Biochemistry. 1976 Dec 14;15(25):5511-9 PMID: 826268
  10. Charon phages: safer derivatives of bacteriophage lambda for DNA cloning.
    Science. 1977 Apr 8;196(4286):161-9 PMID: 847462
  11. Screening lambdagt recombinant clones by hybridization to single plaques in situ.
    Science. 1977 Apr 8;196(4286):180-2 PMID: 322279
  12. Sequence arrangement of tRNA genes on a fragment of Drosophila melanogaster DNA cloned in E. coli.
    Cell. 1977 Aug;11(4):763-77 PMID: 408014
  13. Nucleotide sequence of Bombyx mori L. tRNA1Gly.
    Nature. 1977 Sep 22;269(5626):350-2 PMID: 333294
  14. The nucleotide sequence of a major glycine transfer RNA from the posterior silk gland of Bombyx mori L.
    Nucleic Acids Res. 1977 Dec;4(12):4175-96 PMID: 414206
  15. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system.
    Gene. 1977;2(2):95-113 PMID: 344137
  16. The localization of tRNA4Glu genes from Drosophila melanogaster by "in situ" hybridization.
    Nucleic Acids Res. 1978 May;5(5):1465-78 PMID: 96430
  17. The isolation of structural genes from libraries of eucaryotic DNA.
    Cell. 1978 Oct;15(2):687-701 PMID: 719759
  18. Splicing of yeast tRNA precursors: structure of the reaction intermediates.
    Cell. 1979 Sep;18(1):37-45 PMID: 389432
  19. Transcription of a cloned Bombyx mori tRNA2Ala gene: nucleotide sequence of the tRNA precursor and its processing in vitro.
    Cell. 1979 Nov;18(3):817-28 PMID: 260697
  20. Compilation of tRNA sequences.
    Nucleic Acids Res. 1980 Jan 11;8(1):r1-r22 PMID: 6986608
  21. A control region in the center of the 5S RNA gene directs specific initiation of transcription: I. The 5' border of the region.
    Cell. 1980 Jan;19(1):13-25 PMID: 7357599
  22. A control region in the center of the 5S RNA gene directs specific initiation of transcription: II. The 3' border of the region.
    Cell. 1980 Jan;19(1):27-35 PMID: 7357604
  23. Nucleotide sequence of genes coding for tRNAPhe and tRNATyr from a repeating unit of X. laevis DNA.
    Cell. 1980 Feb;19(2):345-53 PMID: 7357612
  24. The actin genes of Drosophila: a dispersed multigene family.
    Cell. 1980 Feb;19(2):365-78 PMID: 6244106
  25. Hybridization of tRNAs of Drosophila melanogaster to polytene chromosomes.
    Chromosoma. 1980;76(1):65-84 PMID: 6766853
  26. Sequencing end-labeled DNA with base-specific chemical cleavages.
    Methods Enzymol. 1980;65(1):499-560 PMID: 6246368
  27. Analysis of a drosophila tRNA gene cluster.
    Cell. 1980 Apr;19(4):889-95 PMID: 6769590
  28. Nucleotide sequence of Xenopus borealis oocyte 5S DNA: comparison of sequences that flank several related eucaryotic genes.
    Cell. 1978 Dec;15(4):1145-56 PMID: 264240
  29. Genes coding for valine transfer ribonucleic acid-3b in Drosophila melanogaster.
    J Mol Biol. 1979 Mar 5;128(3):277-87 PMID: 108402
  30. The nucleotide sequence of human tRNAGly (anticodon GCC).
    Nucleic Acids Res. 1979 Oct 25;7(4):959-70 PMID: 116197
Article Info
Journal
Nucleic acids research
Abbr.
Nucleic Acids Res
ISSN
0305-1048
DOI
10.1093/nar/8.21.4899
Published
1980-11-11
Pages
4899-910
Language
English
Region
England
NLM ID
0411011
PMCID
PMC324267
Subset
IM
Databases
GENBANK
J01149
External Links
PubMed source DOI: 10.1093/nar/8.21.4899 PMC Full Text View journal details
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2