Home LiteratureArticle Details
PMID: 6280154 Published · ppublish English Journal Article Research Support, Non-U.S. Gov't

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

Nucleic acids research ·Vol. 10 ·No. 5 ·1982-03-11 ·Pages 1625-33

Sor F, Fukuhara H

Abstract

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

MeSH Terms
Base Sequence DNA Restriction Enzymes DNA, Mitochondrial/genetics Mitochondria/metabolism Molecular Weight RNA, Ribosomal/genetics Saccharomyces cerevisiae/genetics Species Specificity Transcription, Genetic
Chemicals
DNA, Mitochondrial RNA, Ribosomal DNA Restriction Enzymes
Authors & Affiliations
2 authors, click to expand affiliations / ORCID
Sor F
Fukuhara H
References (23)
23 references, click to expand
  1. Physical and genetic organization of petite and grande yeast mitochondrial DNA. IV. In vivo transcription products of mitochondrial DNA and localization of 23 S ribosomal RNA in petite mutants of saccharomyces cerevisiae.
    J Mol Biol. 1974 Sep 5;88(1):185-203 PMID: 4613841
  2. Detection of specific sequences among DNA fragments separated by gel electrophoresis.
    J Mol Biol. 1975 Nov 5;98(3):503-17 PMID: 1195397
  3. Restriction endonuclease analysis of mitochondrial DNA from grande and genetically characterized cytoplasmic petite clones of Saccharomyces cerevisiae.
    Proc Natl Acad Sci U S A. 1975 Oct;72(10):3868-72 PMID: 1105566
  4. Modified recombination and transmission of mitochondrial genetic markers in rho minus mutants of Saccharomyces cerevisiae.
    Proc Natl Acad Sci U S A. 1976 Dec;73(12):4608-12 PMID: 794880
  5. The mitochondrial genome of wild-type yeast cells. VI. Genome organization.
    J Mol Biol. 1977 Feb 15;110(1):53-74 PMID: 845947
  6. Restriction cleavage map of mitochonrial DNA from the yeast Saccharomyces cerevisiae.
    Nucleic Acids Res. 1977 Jul;4(7):2331-51 PMID: 333388
  7. Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S1 endonuclease-digested hybrids.
    Cell. 1977 Nov;12(3):721-32 PMID: 922889
  8. An insert in the single gene for the large ribosomal RNA in yeast mitochondrial DNA.
    Nature. 1978 Sep 28;275(5678):336-8 PMID: 357991
  9. Sequence homologies of (guanosine + cytidine)-rich regions of mitochondrial DNA of Saccharomyces cerevisiae.
    J Biol Chem. 1979 Jan 10;254(1):42-3 PMID: 363718
  10. Inserted sequence in the mitochondrial 23S ribosomal RNA gene of the yeast Saccharomyces cerevisiae.
    Mol Gen Genet. 1979 Jan 5;168(1):101-9 PMID: 372737
  11. Assembly of the mitochondrial membrane system. The DNA sequence of a mitochondrial ATPase gene in Saccharomyces cerevisiae.
    J Biol Chem. 1979 Jun 10;254(11):4617-23 PMID: 155696
  12. The complete nucleotide sequence of the ribosomal 16-S RNA from Excherichia coli. Experimental details and cistron heterogeneities.
    Eur J Biochem. 1979 Oct 15;100(2):399-410 PMID: 389624
  13. Mitochondrial and nuclear mutations that affect the biogenesis of the mitochondrial ribosomes of yeast. I. Genetics.
    Mol Gen Genet. 1979;177(1):39-46 PMID: 395414
  14. Mitochondrial and nuclear mutations that affect the biogenesis of the mitochondrial ribosomes of yeast. II. Biochemistry.
    Mol Gen Genet. 1979;177(1):47-56 PMID: 395415
  15. Complete nucleotide sequence of a 23S ribosomal RNA gene from Escherichia coli.
    Proc Natl Acad Sci U S A. 1980 Jan;77(1):201-4 PMID: 6153795
  16. Sequencing end-labeled DNA with base-specific chemical cleavages.
    Methods Enzymol. 1980;65(1):499-560 PMID: 6246368
  17. Sequence of the intron and flanking exons of the mitochondrial 21S rRNA gene of yeast strains having different alleles at the omega and rib-1 loci.
    Cell. 1980 May;20(1):185-97 PMID: 6156002
  18. Excision sites in the GC clusters of the mitochondrial genome of yeast.
    FEBS Lett. 1980 Jun 2;114(2):234-6 PMID: 6248366
  19. Assembly of the mitochondrial membrane system. DNA sequence and organization of the cytochrome b gene in Saccharomyces cerevisiae D273-10B.
    J Biol Chem. 1980 Oct 25;255(20):9828-37 PMID: 6253454
  20. Transfer RNA genes in the cap-oxil region of yeast mitochondrial DNA.
    Nucleic Acids Res. 1980 Nov 11;8(21):5017-30 PMID: 7003547
  21. One gene's intron is another gene's exon.
    Nature. 1981 Feb 5;289(5797):439-40 PMID: 7007884
  22. [Nucleotide sequence of the gene for the mitochondrial 15S ribosomal RNA of yeast].
    C R Seances Acad Sci D. 1980 Dec 8;291(12):933-6 PMID: 6261980
  23. A putative precursor for the small ribosomal RNA from mitochondria of Saccharomyces cerevisiae.
    Nucleic Acids Res. 1981 Mar 25;9(6):1351-64 PMID: 6262728
Article Info
Journal
Nucleic acids research
Abbr.
Nucleic Acids Res
ISSN
0305-1048
DOI
10.1093/nar/10.5.1625
Published
1982-03-11
Pages
1625-33
Language
English
Region
England
NLM ID
0411011
PMCID
PMC320554
Subset
IM
External Links
PubMed source DOI: 10.1093/nar/10.5.1625 PMC Full Text View journal details
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: [email protected]

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2